oligo nomenclature

Just a reminder that if you send oligos for ordering you *must* use the following naming system including all the relevant info. in a succinct format (note that in the primer name you should definitely include the label used or whether it is pigtailed). If you don’t have this info fully done I will just send them back to you 😉

Abbreviated species’ scientific name_no._strand direction_label?_pig tailed?

e.g. Passer domesticus microsat 4 with a 5′ HEX labelled forward primer and a pigtailed reverse

 Pdo4F_HEX       [5HEX]GATAGTAGTGATAGTATA

Pdo4R_pig           GTTCTTGATATTAGTAGATAGTA

eg

e.g. Passer domesticus microsat 5 with a 5′, 6-FAMlabelled forward primer and a non-pigtailed (normal) reverse

 Pdo4F_FAM      [6-FAM]GATAGTAGTGATAGTATA

Pdo4R                  GATATTAGTAGATAGTA

 If you have re-designed the primers you will have to of course add in this fact. How you do this is open to some debate but at least adding in another letter i.e. Pdo4F(A)_FAM or adding in the position of the primer (5′ direction) in the flanking region of the original (and only?) sequence (found in EMBL) i.e. Pdo4F(121-136)_FAM and Pdo4R(350-368)_pig.  Or if you have re-sequenced the fragment in your new species you will need to give it the name of your new species.

I think that makes sense-maybe it needs more debate? if you have any comments please post!

Leave a Reply