Monthly Archives: February 2009

Jaflong

Hi everyone,

It’s my birthday on thursday and I’m planning to go for a curry at Jaflong in Crookes.  Everyone is welcome, so let me know if you want to come (a.llewellyn@shef.ac.uk)  then I can get a table booked.

Cheers,

Amy

Reminder – Illumina presentation B52

Dear all,

Gareth Elvidge, Applications Scientist, and Richard Wood from Illumina will give a technical presentation on the Illumina BeadExpress Goldengate SNP genotyping platform on Tuesday 17 Feb, 12 to 2pm in B52.

The presentation will take a max of 1 hour (possibly less).  Gareth will start with a general presentation of the technology and then talk about the goldengate assays and custom ASPE assays.  This will all be technically orientated rather than sales. No prior knowledge of Illumina assays required.

More info on Illumina: www.illumina.com

PhD opportunity

with Olivier Hanotte in Nottingham;

4 Years PhD – University of Nottingham, School of Biology: “Selection, speciation and conservation among galliform species: a phylogenomic analysis.”
More details here:phd_advert_galliforms.doc

Pancake Day

hi folks

pancake day is fast approaching (tuesday 24th), so i thought i would invite you all for an evening of pancakes and banter at my house. i will provide the pancakes and it will be up to you to bring toppings.  if you dont know where i live, email or ask me. hopefully see you from 7.30pm onwards.

jamie

PhD studentship in Lancaster

Hi all,

Ken Wilson has a PhD studenstship advertised. Details here: kenwilsonphdproject.pdf

afternoon tea

Dear all,

Lisette and I would like to invite you for coffee and pastry next Sunday afternoon. On one hand we feel Lisette passing her viva calls for a celebration, and, on the other hand, it’s carnival time again, so I want to share some pastry again. We were hoping to start around three in the
afternoon, but you could drop in any time of course. Lisette’s house is at 29, Fulton Road in Walkley.

We hope you can make it. Partners are welcome of course.

Alain & Lisette

post doc in south africa

Hi Alain,

I came across this today and thought maybe you could pass it on to anyone in your lab who might be interested in a plant systematics postdoc?

http://www.sanbi.org/frames/jobsfram.htm

Vern

new photocopy code

I have a new one for the whole MolEcol group- come and see me or email me  for the confidential no. ! Remember do double-sided/shrunk copies where necessary (the D-floor office can advise you on how to do this).

oligo nomenclature

Just a reminder that if you send oligos for ordering you *must* use the following naming system including all the relevant info. in a succinct format (note that in the primer name you should definitely include the label used or whether it is pigtailed). If you don’t have this info fully done I will just send them back to you 😉

Abbreviated species’ scientific name_no._strand direction_label?_pig tailed?

e.g. Passer domesticus microsat 4 with a 5′ HEX labelled forward primer and a pigtailed reverse

 Pdo4F_HEX       [5HEX]GATAGTAGTGATAGTATA

Pdo4R_pig           GTTCTTGATATTAGTAGATAGTA

eg

e.g. Passer domesticus microsat 5 with a 5′, 6-FAMlabelled forward primer and a non-pigtailed (normal) reverse

 Pdo4F_FAM      [6-FAM]GATAGTAGTGATAGTATA

Pdo4R                  GATATTAGTAGATAGTA

 If you have re-designed the primers you will have to of course add in this fact. How you do this is open to some debate but at least adding in another letter i.e. Pdo4F(A)_FAM or adding in the position of the primer (5′ direction) in the flanking region of the original (and only?) sequence (found in EMBL) i.e. Pdo4F(121-136)_FAM and Pdo4R(350-368)_pig.  Or if you have re-sequenced the fragment in your new species you will need to give it the name of your new species.

I think that makes sense-maybe it needs more debate? if you have any comments please post!

Terry’s next group meeting…

…is on Friday next week (20/02) from 12 to 1pm in B52.